Sequence ID | >WENV180095651 |
Genome ID | MTBK01080294 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1493 |
End posion on genome | 1408 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tactgtgtaT |
tRNA gene sequence |
GCCAAGATGGTGAAATAGGCAGACACGCTACGTTCAGGACGTAGTCCTAGAAATAGGGTG |
Downstream region at tRNA end position |
atattatatt |
Secondary structure (Cloverleaf model) | >WENV180095651 Leu CAG T AGag atattatatt G - C C - G C - G A - T A - T G - C A - T T C T C C C C C A T A A G | | | | | G A A G T G G G G G G C G | | | T T G A C A C C A G G TCCTAGAAATAGGGT C - G T - A A - T C - G G - C T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |