Sequence ID | >WENV180095653 |
Genome ID | MTBK01080572 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 883 |
End posion on genome | 969 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcacctttcT |
tRNA gene sequence |
GCGGTAGTGGTGGAATTGGTAGACACGCTAGCTTGAGGTGCTAGTGATCGAAAGGTTATG |
Downstream region at tRNA end position |
gagcggcttc |
Secondary structure (Cloverleaf model) | >WENV180095653 Leu GAG T AGCa gagcggcttc G - C C - G G - C G - C T - A A - T G - C T G T T G A C C A T A A G + | | | | A T G G T G G C T G G C G | | | T T G A C A C T A G G TGATCGAAAGGTTAT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |