Sequence ID | >WENV180095665 |
Genome ID | MTBK01081846 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 291 |
End posion on genome | 204 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cccggcctcg |
tRNA gene sequence |
GGAGGGATGCGAGAGCGGACGAATCGGCACGCCTGGAGAGCGTGTGTGGGGCAACCTACC |
Downstream region at tRNA end position |
ccgcgtgttt |
Secondary structure (Cloverleaf model) | >WENV180095665 Ser GGA g GCCA ccgcgtgttt G - C G - C A - T G - C G - C G - C A - T T A T C A C C C A C G A G | | | | | G G G A G C G T G G G C G | | | T T A A T C G C G A G TGTGGGGCAACCTACC C - G A - T C - G G - C C - G C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |