Sequence ID | >WENV180095673 |
Genome ID | MTBK01082192 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4639 |
End posion on genome | 4722 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tttttggtgt |
tRNA gene sequence |
GCGGGTGTGGCGGAACTGGCAGACGCACTAGACTTAGGATCTAGCGCCTTGGGCATGCAG |
Downstream region at tRNA end position |
tgagatttga |
Secondary structure (Cloverleaf model) | >WENV180095673 Leu TAG t ACCA tgagatttga G - C C - G G - C G - C G - C T - A G - C T T T T G T C C A C A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C C A G A CGCCTTGGGCAT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |