Sequence ID | >WENV180095687 |
Genome ID | MTBK01082839 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 92 |
End posion on genome | 166 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcaagggga |
tRNA gene sequence |
TGCAGGGTAGAGTAACGGTATCTCGCCAGCCTCATAAGCTGGAGACTACGGGTTCGATTC |
Downstream region at tRNA end position |
atgcgtccgg |
Secondary structure (Cloverleaf model) | >WENV180095687 fMet CAT a ACCA atgcgtccgg T T G - C C - G A - T G - C G - C G - C T T T T G C C C A A A A | | | | | G C T G A G A C G G G C G | | | T T G T C T C T A G AGACT C - G C - G A - T G - C C - G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |