Sequence ID | >WENV180095703 |
Genome ID | MTBK01083867 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 101907 |
End posion on genome | 101981 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aactgcttgt |
tRNA gene sequence |
GTCCGGTTCGTCTAGGGGTTAGGACACCGCCCTTTCACGGCGGCAACACGGGTTCAAATC |
Downstream region at tRNA end position |
tctcaatcgg |
Secondary structure (Cloverleaf model) | >WENV180095703 Glu TTC t ACCA tctcaatcgg G + T T - A C - G C - G G - C G - C T - A T A T T G C C C A G G A C | | | | | A G T C T G A C G G G C G + | | | T T T G G A C T A A CAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |