Sequence ID | >WENV180095704 |
Genome ID | MTBK01083867 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 123423 |
End posion on genome | 123498 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aagagttctc |
tRNA gene sequence |
GGGCATGTATGTCAATTGGTAGACAGCCTCTCTTACAAGGAGGAAGTTAGGGGTTCGAGT |
Downstream region at tRNA end position |
gatccaattg |
Secondary structure (Cloverleaf model) | >WENV180095704 Val TAC c ACCA gatccaattg G - C G - C G - C C - G A - T T + G G - C T G T T T C C C A T A A A | + | | | G T C T G T A G G G G C G | | | | T T G G A C A T A G AAGTT C - G C - G T - A C - G T + G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |