Sequence ID | >WENV180095706 |
Genome ID | MTBK01083867 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 171282 |
End posion on genome | 171357 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ggtttcgttt |
tRNA gene sequence |
GGGGATGTAGCTCAGCTGGGAGAGCGCGGCGTTCGCAATGCCGAGGCCAGGAGTTCGATC |
Downstream region at tRNA end position |
ttttcctaga |
Secondary structure (Cloverleaf model) | >WENV180095706 Ala CGC t ACCA ttttcctaga G - C G - C G + T G - C A - T T - A G - C C T T T C C T C A C G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A G AGGCC C - G G - C G - C C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |