Sequence ID | >WENV180095729 |
Genome ID | MTBK01085067 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 929 |
End posion on genome | 1015 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gctttataat |
tRNA gene sequence |
GCCGGGATGGCGGAATAGGTAGACGCGCCAGCTTGAGGGGCTGGTAGGTGTATACTTGTG |
Downstream region at tRNA end position |
ttgtttgtct |
Secondary structure (Cloverleaf model) | >WENV180095729 Leu GAG t ACCA ttgtttgtct G - C C - G C - G G - C G - C G - C A - T T A T C C C C C A T A A G | | | | | A A G G C G G G G G G C G | | | T T G A C G C T A G G TAGGTGTATACTTGT C - G C - G A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |