Sequence ID | >WENV180095734 |
Genome ID | MTBK01085287 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 664 |
End posion on genome | 579 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtataaatt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCACGACTCAAAATCGTGTGGGCTAGCCCCATGA |
Downstream region at tRNA end position |
tatgaaaaag |
Secondary structure (Cloverleaf model) | >WENV180095734 Leu CAA t ACCA tatgaaaaag G - C C - G C - G G - C A - T A - T G - C T C T C T C C C A T A A G | | | | | G T G G T G G A G G G C G | | | T T G A C A C T A G G TGGGCTAGCCCCAT C - G A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |