Sequence ID | >WENV180095748 |
Genome ID | MTBK01085971 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 164 |
End posion on genome | 81 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttacttaata |
tRNA gene sequence |
GCCGAAGTGGTGGAACTGGTAGACGCACTGGATTCAAAATCCAGCGGGGGCAACCCCATG |
Downstream region at tRNA end position |
ctccacaaaa |
Secondary structure (Cloverleaf model) | >WENV180095748 Leu CAA a Aaaa ctccacaaaa G - C C - G C - G G - C A - T A - T G - C T G T C T C C C A C A A G | | | | | A T G G T G G A G G G C G | + | T T G A C G C T A G A CGGGGGCAACCCCAT C - G T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |