Sequence ID | >WENV180095750 |
Genome ID | MTBK01085987 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 61306 |
End posion on genome | 61378 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cccgtggttc |
tRNA gene sequence |
GGGCGTGTAGCTCAGTGGTAGAGCTCTGGTTTTACACACCAGCGGTCGGCGGTTCGATAC |
Downstream region at tRNA end position |
gatttccggc |
Secondary structure (Cloverleaf model) | >WENV180095750 Val TAC c ACtc gatttccggc G - C G - C G - C C - G G - C T - A G - C A T T C T G C C A G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A T CGGTC C - G T - A G - C G - C T - A T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |