Sequence ID | >WENV180095761 |
Genome ID | MTBK01086946 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3687 |
End posion on genome | 3773 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cacataaaat |
tRNA gene sequence |
GCCGCGATGGCGAAATTGGTAGACGCATCGGACTTAAAATCCGACGATATTAAAACATCA |
Downstream region at tRNA end position |
tggcttattt |
Secondary structure (Cloverleaf model) | >WENV180095761 Leu TAA t ACgc tggcttattt G - C C - G C - G G - C C - G G - C A - T T G T C T C C C A T A A G | | | | | G T A G C G G A G G G C G | | | T T G A C G C T A G A CGATATTAAAACATCAT T - A C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |