Sequence ID | >WENV180095772 |
Genome ID | MTBK01087818 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 22258 |
End posion on genome | 22184 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tgcgaaatgt |
tRNA gene sequence |
AGGCACTTAGCTCAGTGGTAGAGCACTACCTTGACACGGTAGGGGTCAGCAGTTCAACTC |
Downstream region at tRNA end position |
tttacaattt |
Secondary structure (Cloverleaf model) | >WENV180095772 Val GAC t ACCA tttacaattt A - T G - C G - C C - G A - T C - G T - A T C T T C G T C A G A A | | | | | A T C T C G A G C A G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |