Sequence ID | >WENV180095775 |
Genome ID | MTBK01088528 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 249 |
End posion on genome | 320 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ttacttaaaa |
tRNA gene sequence |
GGGCCCGTAGTAGAATGGCAGCACGCCGCATTCGCATTGCGGAGACGCGAGTTCGATTCT |
Downstream region at tRNA end position |
tttactaatt |
Secondary structure (Cloverleaf model) | >WENV180095775 Ala CGC a ACta tttactaatt G - C G - C G + T C - G C - G C - G G - C T T T C G C T C A A A A | | | | | G T G A T G G C G A G C G | | T T G G C A C C A G AGAC C - G C - G G - C C - G A - T T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |