Sequence ID | >WENV180095779 |
Genome ID | MTBK01088867 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 12727 |
End posion on genome | 12812 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atctatacgc |
tRNA gene sequence |
GCGGGGGTTGCCGAGCCCGGTCAAAGGCGACGGATTTAGGGTCCGTTCTCGAAGGAGTTC |
Downstream region at tRNA end position |
tttccttcat |
Secondary structure (Cloverleaf model) | >WENV180095779 Leu TAG c ACtc tttccttcat G - C C - G G - C G - C G - C G - C G - C T A T T T C C C A C C G A T | | | | | G C G C C G A A G G G C G | | | T T G A G G C T C A A G TCTCGAAGGAGTTC A - T C - G G - C G - C A - T T G T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |