Sequence ID | >WENV180095793 |
Genome ID | MTBK01089788 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 214 |
End posion on genome | 142 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
tagttttgat |
tRNA gene sequence |
TGCAGGATAATTCAGCGGTAGAAGTTTAGGCTCATAACCTAAAAGCCGGTGGTTCAATTC |
Downstream region at tRNA end position |
tttccattta |
Secondary structure (Cloverleaf model) | >WENV180095793 fMet CAT t ACaa tttccattta T T G - C C - G A - T G - C G - C A - T T T T C C A C C A G A A | | | | | A C C T T A G G T G G C G | | | T T G G A A G T A T AAGCC T - A T - A A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |