Sequence ID | >WENV180095802 |
Genome ID | MTBK01090262 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 158612 |
End posion on genome | 158538 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ataaagctac |
tRNA gene sequence |
GGGGATATAGCTCAGTTGGCTAGAGCACCTGCTTTGCAAGCAGGGGGTCGTCGGTTCGAC |
Downstream region at tRNA end position |
atggcgcgtt |
Secondary structure (Cloverleaf model) | >WENV180095802 Ala TGC c ACaa atggcgcgtt G - C G - C G + T G - C A - T T - A A - T T C T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C C T A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |