Sequence ID | >WENV180095807 |
Genome ID | MTBK01090773 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 639 |
End posion on genome | 552 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
agccttgcac |
tRNA gene sequence |
GGAGGGTTGTCCGAGTGGTCGATGGTGCGACTCTCGAAAAGTCGTGTTCCGACAGGAACC |
Downstream region at tRNA end position |
aaaacccgcg |
Secondary structure (Cloverleaf model) | >WENV180095807 Ser CGA c GCCA aaaacccgcg G - C G - C A - T G - C G - C G - C T - A T A T A T C C C A T G A G | | | | | G G G C C T T A G G G C G + | | T T T T G G T C G A G TGTTCCGACAGGAACC C - G G - C A - T C - G T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |