Sequence ID | >WENV180095808 |
Genome ID | MTBK01090823 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1640 |
End posion on genome | 1730 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
actcgttcgc |
tRNA gene sequence |
GGTGACGTGTCCGAGCGGCCGAAGGTGCAACTCTCGAAAAGTTGTGTAGGGTAACCCCCT |
Downstream region at tRNA end position |
ccgaaaaccc |
Secondary structure (Cloverleaf model) | >WENV180095808 Ser CGA c GCCA ccgaaaaccc G - C G - C T - A G - C A - T C - G G - C T A T C A C C C A C G A G | | | | | A G G C C T G T G G G C G | | T T C A G G T C G A G TGTAGGGTAACCCCCTACC C - G A - T A - T C - G T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |