Sequence ID | >WENV180095816 |
Genome ID | MTBK01091179 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 486 |
End posion on genome | 395 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccgatttgg |
tRNA gene sequence |
GGAGAGGTGACCGAGCTGGCTGAAGGTGCACGCCTGCTAAGCGTGTGTGGGTCAAAAGCC |
Downstream region at tRNA end position |
ttagatattt |
Secondary structure (Cloverleaf model) | >WENV180095816 Ser GCT g GCCA ttagatattt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T C G A G | | | | | G G G C C A G A G G G C G | | | T T C A G G T T G A G TGTGGGTCAAAAGCCCACC C - G A - T C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |