Sequence ID | >WENV180095838 |
Genome ID | MTBK01092669 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 15360 |
End posion on genome | 15270 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gggcgcttgc |
tRNA gene sequence |
GGAGACGTGGCTGAGCGGCTGAAAGCGGCGGTTTGCTAAATCGTTAAGGGTCAAAAGCCC |
Downstream region at tRNA end position |
tcatttgcga |
Secondary structure (Cloverleaf model) | >WENV180095838 Ser GCT c GCCA tcatttgcga G - C G - C A - T G - C A - T C - G G - C T A T T G T C C A C G A G | | | | | G G G T C G A C A G G C G | | | T T C A A G C T G A G TAAGGGTCAAAAGCCCTTC G + T C - G G - C G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |