Sequence ID | >WENV180095856 |
Genome ID | MTBK01093867 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 167 |
End posion on genome | 251 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaaagtaaat |
tRNA gene sequence |
GCGTCGGTACTCAAGTGGTCAACGAGGGCAGACTGTAAATCTGCTGACCTTAGGTCTTCG |
Downstream region at tRNA end position |
aagcgtgagc |
Secondary structure (Cloverleaf model) | >WENV180095856 Tyr GTA t ACaa aagcgtgagc G - C C - G G - C T + G C - G G - C G - C T A T C C T T C A T G A A | | | | | G G A C T C G G A A G C G | | | T T T C G A G C A A G TGACCTTAGGTCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |