Sequence ID | >WENV180095868 |
Genome ID | MTBK01094767 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2301 |
End posion on genome | 2217 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gtctgaaacT |
tRNA gene sequence |
GGGGCAGTGGCGGAATGGCAGACGCAAAGGACTTAAAATCCTTCGGTATTTATACCGTGT |
Downstream region at tRNA end position |
ttttattgtc |
Secondary structure (Cloverleaf model) | >WENV180095868 Leu TAA T ATgt ttttattgtc G + T G - C G - C G - C C - G A - T G - C T C T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T C A C G C A G A CGGTATTTATACCGT A - T A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |