Sequence ID | >WENV180095879 |
Genome ID | MTBK01095470 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1344 |
End posion on genome | 1253 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
aggtgttctT |
tRNA gene sequence |
GTCCCGATGGGGTAGTGGATATCCCGGAGGCCTGCGGAGCATTTTTCGCGCAGAGAGCCT |
Downstream region at tRNA end position |
tatttatcct |
Secondary structure (Cloverleaf model) | >WENV180095879 Arg GCG T GTga tatttatcct G - C T - A C - G C - G C - G G - C A - T T A T G G C C C A T G A G | | | | | G G T G G G C C G G G C G | | | T T A T C C C T A G TTTCGCGCAGAGAGCCTTCAAC G + T A - T G A G - C C - G C A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |