Sequence ID | >WENV180095880 |
Genome ID | MTBK01095493 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 154 |
End posion on genome | 69 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaccagttgt |
tRNA gene sequence |
GGAGGATTAGTCCTAATTGGTAAGGCAGCGGTCTTGAAAACCGCCGGGTTCTGCCCTTGG |
Downstream region at tRNA end position |
caaccatagt |
Secondary structure (Cloverleaf model) | >WENV180095880 Ser TGA t GCCA caaccatagt G - C G - C A - T G - C G - C A - T T - A T A T C T C C C A A A T A | + | | | G T C C T G G G G G G C T | + | T T G A G G C G T A A CGGGTTCTGCCCTT G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |