Sequence ID | >WENV180095884 |
Genome ID | MTBK01095772 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 246 |
End posion on genome | 152 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
acaggagagc |
tRNA gene sequence |
GGAGAGATACCGAAGTGGTCATAACGGGACCGACTCGAAATCGGTTTGAGGGCCTAACAG |
Downstream region at tRNA end position |
ttattttctt |
Secondary structure (Cloverleaf model) | >WENV180095884 Ser CGA c GCCA ttattttctt G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A G T G A A | | | | | G G A G C C G G G G G C T | | | T T C A C G G A T A G TTGAGGGCCTAACAGCTCTCAC A - T C - G C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |