Sequence ID | >WENV180095895 |
Genome ID | MTBK01096536 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3062 |
End posion on genome | 2976 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaatacatcc |
tRNA gene sequence |
GCCGGTGTGTTGGAATTGGCAGACGAGACGGACTCAAAATCCGTTGTTCTTAGGGACGTG |
Downstream region at tRNA end position |
gccaacaaac |
Secondary structure (Cloverleaf model) | >WENV180095895 Leu CAA c ACCA gccaacaaac G - C C - G C - G G - C G - C T - A G - C T G T C A C C C A T A A G | | | | | G T G G T T G T G G G C G | + | T T G A C G A C A G G TGTTCTTAGGGACGT A - T C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |