Sequence ID | >WENV180095902 |
Genome ID | MTBK01096861 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 983 |
End posion on genome | 890 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tacttggtgc |
tRNA gene sequence |
GGAGATGTGTCCGAGCTGGCTGAAGGAGCACGATTGGAAATCGTGTGTACGTGCAAAACG |
Downstream region at tRNA end position |
ttttttttct |
Secondary structure (Cloverleaf model) | >WENV180095902 Ser GGA c GCCA ttttttttct G - C G - C A - T G - C A - T T - A G - C T A T A A C C C A T C G A G | | | | | G G G C C T T T G G G C G | | | T T C A G G A T G A G TGTACGTGCAAAACGCGTACC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |