Sequence ID | >WENV180095936 |
Genome ID | MTBK01099241 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1794 |
End posion on genome | 1704 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cgacggttca |
tRNA gene sequence |
GGAGGCGTGCCAGAGCGGCCGAATGGGACTCACTGCTAATGAGTTGTCCCCCTTAAAGGG |
Downstream region at tRNA end position |
cggtcggact |
Secondary structure (Cloverleaf model) | >WENV180095936 Ser GCT a GCCg cggtcggact G - C G - C A - T G - C G - C C - G G - C T A T T C T C C A C G A G + | | | | A G G A C C G G A G G C G | | | T T C A T G G C G A G TGTCCCCCTTAAAGGGGACC A - T C - G T - A C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |