Sequence ID | >WENV180095944 |
Genome ID | MTBK01099452 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2877 |
End posion on genome | 2956 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
atatataagt |
tRNA gene sequence |
GGCCCGTTGGTCAAATGGTTAAGACGCGACCCTTTCAAGGTCGAGACGCTTTATGGGTTC |
Downstream region at tRNA end position |
tatagcgact |
Secondary structure (Cloverleaf model) | >WENV180095944 Glu TTC t ACCA tatagcgact G - C G + T C - G C - G C - G G - C T - A T T T C G C C C A T A A G + | | | G G A C T G A T G G G C G | | | T T T A G A C T A G AGACGCTTT C - G G - C A - T C - G C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |