Sequence ID | >WENV180095956 |
Genome ID | MTBK01099869 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 23913 |
End posion on genome | 23984 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
caatcccaac |
tRNA gene sequence |
TGAGCTATGGTGTAATGGTAGCACTACAGATTTTGGTTCTGTCTGTCTAGGTTCGAGTCC |
Downstream region at tRNA end position |
aaaacaatca |
Secondary structure (Cloverleaf model) | >WENV180095956 Gln TTG c ACtc aaaacaatca T - A G - C A - T G - C C - G T - A A - T T G T G A T C C A A A G | | | | | G T T G T G C T A G G C G + | | | T T G G C A C T A T CTGT A - T C - G A - T G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |