Sequence ID | >WENV180095969 |
Genome ID | MTBK01100099 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1188 |
End posion on genome | 1278 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ggtgatctgc |
tRNA gene sequence |
GGAGGAGTGCCCGAGCGGATGAAGGGAGCGGTCTTGAAAATCGCCAGGGTCTTCATGGCC |
Downstream region at tRNA end position |
tctgttctta |
Secondary structure (Cloverleaf model) | >WENV180095969 Ser TGA c GCCA tctgttctta G - C G - C A - T G - C G - C A - T G - C T A T C A C C C A C G A G | | | | | G G G C C C G T G G G C G | | | T T A A G G G T G A A CAGGGTCTTCATGGCCCTC G - C C - G G - C G + T T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |