Sequence ID | >WENV180095970 |
Genome ID | MTBK01100099 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1681 |
End posion on genome | 1775 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
taacctgagc |
tRNA gene sequence |
GGAGAGATACCCAAGCTGGCTGAAGGGGAAGGTTTGCTAAACCTTTAGGCGGTGCAACAA |
Downstream region at tRNA end position |
ttttcatttc |
Secondary structure (Cloverleaf model) | >WENV180095970 Ser GCT c GCCA ttttcatttc G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A T C G A A | | | | | G G A C C C G G G G G C G | | | T T C A G G G T G A G TAGGCGGTGCAACAAACCGCGC A - T A - T G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |