Sequence ID | >WENV180095978 |
Genome ID | MTBK01100315 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1443 |
End posion on genome | 1371 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tgttacaatt |
tRNA gene sequence |
GCTGGTGTAGCTCAGTTGGTAGAGCATTCCCTTCGTAAGGGACAGGTCGACGGTTCAAAT |
Downstream region at tRNA end position |
tagagaaatt |
Secondary structure (Cloverleaf model) | >WENV180095978 Thr CGT t Tttt tagagaaatt G - C C - G T - A G - C G - C T - A G - C T A T C C G C C A T G A A | | | | A T C T C G G A C G G C G | | | | T T G G A G C T A A AGGTC T C T - A C - G C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |