Sequence ID | >WENV180096002 |
Genome ID | MTBK01101807 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 507 |
End posion on genome | 433 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttttattgc |
tRNA gene sequence |
TGGGGTGTAGCCAAGCGGTAAGGCACGGGATTTTGGATCCCGCATGCGTAGGTTCGAATC |
Downstream region at tRNA end position |
ttttttttga |
Secondary structure (Cloverleaf model) | >WENV180096002 Gln TTG c GCCA ttttttttga T - A G - C G - C G - C G - C T - A G - C T A T C T T C C A G A A | | | | G C A C C G G T A G G C G | | | T T G A G G C T A A CATGC C - G G - C G - C G - C A - T T A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |