Sequence ID | >WENV180096039 |
Genome ID | MTBK01104583 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2298 |
End posion on genome | 2214 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gacgtgcccc |
tRNA gene sequence |
GGTGGGGTAGCGAAGTGGCCAACCGCAGCAGACTGTAAATCTGCCCTCTATGAGTTCGAA |
Downstream region at tRNA end position |
tcttgagcgt |
Secondary structure (Cloverleaf model) | >WENV180096039 Tyr GTA c ACCA tcttgagcgt G - C G - C T - A G - C G - C G - C G - C T A T C T T C C A T G A A | | | | | G G A G C G G A A G G C G | | | T T C C C G C C A A A CCTCTATGAGTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |