Sequence ID | >WENV180096040 |
Genome ID | MTBK01104744 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1305 |
End posion on genome | 1219 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ttcgtttcga |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTAGGTTCAGGGTCTAGTGACCGTAGGGTCGTG |
Downstream region at tRNA end position |
gagtttataa |
Secondary structure (Cloverleaf model) | >WENV180096040 Leu CAG a ACCA gagtttataa G - C C - G C - G G - C A - T A - T G - C T G T C C C T C A T A A G | | | | | G T G G T G G G G A G C G | | | T T G A C A C T A G G TGACCGTAGGGTCGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |