Sequence ID | >WENV180096050 |
Genome ID | MTBK01105422 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 14887 |
End posion on genome | 14961 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cgttgcggac |
tRNA gene sequence |
GGCCCCATGGTCAAGTGGTCAAGACGTCGCCCTCTCACGGCGAAATCAGGAGTTCGACTC |
Downstream region at tRNA end position |
ggacgcggcc |
Secondary structure (Cloverleaf model) | >WENV180096050 Glu CTC c ACCA ggacgcggcc G - C G + T C - G C - G C - G C - G A - T T C T T C C T C A T G A G | | | | | G G A C T G A G G A G C G | | | T T T A G A C C A G AATC T - A C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |