Sequence ID | >WENV180096051 |
Genome ID | MTBK01105422 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 14966 |
End posion on genome | 15053 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcaccaggac |
tRNA gene sequence |
GCGGCCATGGCGGAATTGGCAGACGCGCTAGATTCAGGTTCTAGTCGGGGTAAACCCGGT |
Downstream region at tRNA end position |
attaatgacc |
Secondary structure (Cloverleaf model) | >WENV180096051 Leu CAG c ACCA attaatgacc G - C C - G G - C G - C C - G C - G A - T T G T T C T C C A T A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C C A G G TCGGGGTAAACCCGGT C - G T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |