Sequence ID | >WENV180096073 |
Genome ID | MTBK01107304 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 9558 |
End posion on genome | 9629 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acacaccact |
tRNA gene sequence |
GCGACCGTCGTATACCGGTATTACCCGAGCTTCCCAAGCTCGTGAAGCGGGTTCGACTCC |
Downstream region at tRNA end position |
tcttcctaaa |
Secondary structure (Cloverleaf model) | >WENV180096073 Gly CCC t TCta tcttcctaaa G - C C - G G - C A - T C - G C - G G - C T C T T G C C C A C A C + | | | | G C T A T G G C G G G C G | | | T T G T T A C T A C TGAA C - G G - C A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |