Sequence ID | >WENV180096075 |
Genome ID | MTBK01107400 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 230 |
End posion on genome | 157 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aaggcatccc |
tRNA gene sequence |
GCCCCTGTAACTCAATGGTAGAGTAACTGCCTTTTAAGCAGCTAACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
cgaataagga |
Secondary structure (Cloverleaf model) | >WENV180096075 Lys TTT c ACCA cgaataagga G - C C - G C - G C - G C - G T - A G - C T T T C C C C C A A A A | | | | G T C T C A G A G G G C G | | | | T T G G A G T T A A TAAC A C C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |