Sequence ID | >WENV180096079 |
Genome ID | MTBK01107718 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1674 |
End posion on genome | 1748 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaaaaattgc |
tRNA gene sequence |
TGGGCAGTCGCCAAGTGGTAAGGCAGCAGGTTTTGGTCCTGCCATCCGAGGGTTCGAATC |
Downstream region at tRNA end position |
aaatataaaa |
Secondary structure (Cloverleaf model) | >WENV180096079 Gln TTG c GCCA aaatataaaa T - A G - C G - C G - C C - G A - T G - C T A T C T T C C A G A C | | + | | G T A C C G G A G G G C G | | | T T G A G G C T A A CATCC G - C C - G A - T G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |