Sequence ID | >WENV180096081 |
Genome ID | MTBK01107776 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2139 |
End posion on genome | 2222 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcctattat |
tRNA gene sequence |
GCGGACGTGGCGTAATTGGTAGCCGCGCCAGACTTAGGATCTGGTGCCGAAAGGCGTGGG |
Downstream region at tRNA end position |
gtaaataaaa |
Secondary structure (Cloverleaf model) | >WENV180096081 Leu TAG t ACCt gtaaataaaa G - C C - G G - C G - C A - T C - G G - C T G T T T C C C A T A A G + + | | | G T T G C G G G G G G C G | | | T T G C C G C T A G G TGCCGAAAGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |