Sequence ID | >WENV180096089 |
Genome ID | MTBK01108579 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 19282 |
End posion on genome | 19354 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tggtaccggT |
tRNA gene sequence |
GCGATAGTAGTCTAGCGGTAGGACAGGGGCTTCCCAAGCCTCTAGCCCGGGTTCGATTCC |
Downstream region at tRNA end position |
ctatccgatc |
Secondary structure (Cloverleaf model) | >WENV180096089 Gly CCC T ATac ctatccgatc G - C C - G G - C A - T T - A A - T G - C T T T G G C C C A G A A | | | | | G C T C T G C C G G G C G + | | | T T G G G A C T A A TAGC G - C G + T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |