Sequence ID | >WENV180096090 |
Genome ID | MTBK01108672 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 901 |
End posion on genome | 991 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tatagcttgc |
tRNA gene sequence |
GGAGAGATGGCTGAGCTGGTCGAAAGCGCTCGCCTCGAAAGCGAGTAGGCGGGGAACCGC |
Downstream region at tRNA end position |
tagattctga |
Secondary structure (Cloverleaf model) | >WENV180096090 Ser CGA c GCCA tagattctga G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A T C G A G | | | | | G G G T C G G T G G G C G | | | T T T A A G C C G A G TAGGCGGGGAACCGCCTC C - G T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |