Sequence ID | >WENV180096108 |
Genome ID | MTBK01110318 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 231 |
End posion on genome | 140 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccaatcgctt |
tRNA gene sequence |
GGAGAGATGGCTGAGCTGGTCTAAGGCGCACGACTGGAAATCGTGTGTCGCCCTTAAAGC |
Downstream region at tRNA end position |
caaacccact |
Secondary structure (Cloverleaf model) | >WENV180096108 Ser GGA t GCCA caaacccact G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T C G A G | | | | | G G G T C G G A G G G C G + | | T T T A G G C C T A G TGTCGCCCTTAAAGCGACC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |