Sequence ID | >WENV180096109 |
Genome ID | MTBK01110473 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 350 |
End posion on genome | 441 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atataaatac |
tRNA gene sequence |
GGAAGTGTGACCGAGCTGGCCGAAGGTGCACGACTGGAAATCGTGTGTACCCCATAAGGG |
Downstream region at tRNA end position |
tagacacacg |
Secondary structure (Cloverleaf model) | >WENV180096109 Ser GGA c GCCA tagacacacg G - C G - C A - T A - T G - C T + G G - C T A T T T C C C A T C G A G | | | | | A G G C C A A A G G G C G | | | T T C A G G T C G A G TGTACCCCATAAGGGTACC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |