Sequence ID | >WENV180096152 |
Genome ID | MTBK01113231 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 122 |
End posion on genome | 208 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aacattcact |
tRNA gene sequence |
GCCGGAGTGGTGGAACTGGTAGACGCGTCGGACTCAAAATCCGATGAGCGCAAGCTCGTG |
Downstream region at tRNA end position |
tgttttatcc |
Secondary structure (Cloverleaf model) | >WENV180096152 Leu CAA t ACCA tgttttatcc G - C C - G C - G G - C G - C A - T G - C T G T T T C C C A C A A G + + | | | A T G G T G G G G G G C G | + | T T G A C G C T A G G TGAGCGCAAGCTCGT T - A C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |