Sequence ID | >WENV180096154 |
Genome ID | MTBK01113307 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1009 |
End posion on genome | 938 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccccgcattt |
tRNA gene sequence |
GGCGCCGTACCCAAGTGGTAAGGGAGAGGTCTGCAAAACCTTTATACATCGGTTCGATTC |
Downstream region at tRNA end position |
tgagctgtgc |
Secondary structure (Cloverleaf model) | >WENV180096154 Cys GCA t Taat tgagctgtgc G - C G - C C - G G - C C - G C - G G - C T T T T A G C C A G A A | | | | | G T A C C C A T C G G C G | | | T T G A G G G T A A TATAC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |